Orthologous regulated operons containing Pjdr2_1896 gene
| Regulog: | YhcF2 - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paenibacillus sp. JDR-2 | ||||
|
Position: -35
Score: 6.01543 Sequence: TTGTATTAGTCGATTAATACAG
Locus tag: Pjdr2_1896
Name: null Funciton: hypothetical protein
Locus tag: Pjdr2_1897
Name: null Funciton: hypothetical protein
Locus tag: Pjdr2_1898
Name: null Funciton: hypothetical protein
Locus tag: Pjdr2_1899
Name: null Funciton: ABC transporter related |
||||
| Pjdr2_1896-Pjdr2_1897-Pjdr2_1898-Pjdr2_1899 | -35 | 6 | TTGTATTAGTCGATTAATACAG | Pjdr2_1896 |