Orthologous regulated operons containing hutD gene
Regulog: | HutC - Pseudomonadaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudomonas mendocina ymp | ||||
Position: -212
Score: 4.60639 Sequence: TGTTTTGTATATACAATATG
Position: -27
Score: 4.23414 Sequence: GACCATGTATATACATTTGG
Locus tag: Pmen_4074
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutD | -212 | 4.6 | TGTTTTGTATATACAATATG | Pmen_4074 |
-27 | 4.2 | GACCATGTATATACATTTGG |