Orthologous regulated operons containing hutG gene
| Regulog: | HutC - Nocardiaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Nocardia farcinica IFM 10152 | ||||
|
Position: -99
Score: 5.89491 Sequence: CAGCCTGTCTATACAGGCAT
Locus tag: nfa12330
Name: COG1457 Funciton: Predicted histidine transporter, Purine-cytosine permease family
Locus tag: nfa12340
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: nfa12350
Name: hutG Funciton: Formiminoglutamase (EC 3.5.3.8) |
||||
| COG1457-hutI-hutG | -99 | 5.9 | CAGCCTGTCTATACAGGCAT | nfa12330 |
| Rhodococcus erythropolis PR4 | ||||
|
Position: -151
Score: 6.06761 Sequence: ACGCCTGTATATACAGGCAT
Locus tag: RER_51330
Name: COG1457 Funciton: Predicted histidine transporter, Purine-cytosine permease family
Locus tag: RER_51340
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: RER_51350
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: RER_51360
Name: hutG Funciton: Formiminoglutamase (EC 3.5.3.8) |
||||
| COG1457-hutU-hutI-hutG | -151 | 6.1 | ACGCCTGTATATACAGGCAT | RER_51330 |
| Rhodococcus opacus B4 | ||||
|
Position: -134
Score: 4.69454 Sequence: GGGGTTGTCTATACAGGACT
Locus tag: ROP_47400
Name: COG1457 Funciton: Predicted histidine transporter, Purine-cytosine permease family
Locus tag: ROP_47390
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: ROP_47380
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: ROP_47370
Name: hutG Funciton: Formiminoglutamase (EC 3.5.3.8) |
||||
| COG1457-hutU-hutI-hutG | -134 | 4.7 | GGGGTTGTCTATACAGGACT | ROP_47400 |
| Rhodococcus sp. RHA1 | ||||
|
Position: -136
Score: 4.69454 Sequence: GGGGTTGTCTATACAGGACT
Locus tag: RHA1_ro04643
Name: COG1457 Funciton: Predicted histidine transporter, Purine-cytosine permease family
Locus tag: RHA1_ro04642
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: RHA1_ro04641
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: RHA1_ro04640
Name: hutG Funciton: Formiminoglutamase (EC 3.5.3.8) |
||||
| COG1457-hutU-hutI-hutG | -136 | 4.7 | GGGGTTGTCTATACAGGACT | RHA1_ro04643 |