Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yhcI gene

Properties
Regulog: YhcF - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Phylum: Firmicutes
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -42
Score: 6.68084
Sequence: AGTGTATTATTTAATTAGTACACC
Locus tag: Athe_2352
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: Athe_2351
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Athe_2350
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Athe_2349
Name: yhcJ
Funciton: Conserved membrane protein
Locus tag: Athe_2348
Name: yhcH
Funciton: ABC transporter, ATP-binding protein
Locus tag: Athe_2347
Name: yhcK
Funciton: Conserved membrane protein
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK -42 6.7 AGTGTATTATTTAATTAGTACACC Athe_2352
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -43
Score: 6.75778
Sequence: AGTGTATTATTTAATTAACACACT
Locus tag: Csac_0140
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: Csac_0141
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Csac_0142
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Csac_0143
Name: yhcJ
Funciton: Conserved membrane protein
Locus tag: Csac_0144
Name: yhcH
Funciton: ABC transporter, ATP-binding protein
Locus tag: Csac_0145
Name: yhcK
Funciton: Conserved membrane protein
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK -43 6.8 AGTGTATTATTTAATTAACACACT Csac_0140
Moorella thermoacetica ATCC 39073
Position: -56
Score: 4.98509
Sequence: AGTGCACTATTGCAATAGTGCACT
Locus tag: Moth_1175
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: Moth_1174
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Moth_1173
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI -56 5 AGTGCACTATTGCAATAGTGCACT Moth_1175