Orthologous regulated operons containing yhcH gene

Properties
Regulog:	YhcF - Thermoanaerobacterales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -42 Score: 6.68084 Sequence: AGTGTATTATTTAATTAGTACACC Locus tag: Athe_2352 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Athe_2351 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Athe_2350 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Athe_2349 Name: yhcJ Funciton: Conserved membrane protein Locus tag: Athe_2348 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Athe_2347 Name: yhcK Funciton: Conserved membrane protein
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK	-42	6.7	AGTGTATTATTTAATTAGTACACC	Athe_2352
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -43 Score: 6.75778 Sequence: AGTGTATTATTTAATTAACACACT Locus tag: Csac_0140 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Csac_0141 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Csac_0142 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Csac_0143 Name: yhcJ Funciton: Conserved membrane protein Locus tag: Csac_0144 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Csac_0145 Name: yhcK Funciton: Conserved membrane protein
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK	-43	6.8	AGTGTATTATTTAATTAACACACT	Csac_0140

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --