Orthologous regulated operons containing yhcH gene
Regulog: | YhcF - Thermoanaerobacterales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Metabolite transport; Multidrug efflux; Multidrug resistance |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Anaerocellum thermophilum DSM 6725 | ||||
Position: -42
Score: 6.68084 Sequence: AGTGTATTATTTAATTAGTACACC
Locus tag: Athe_2352
Name: yhcF Funciton: Transcriptional regulator, GntR family
Locus tag: Athe_2351
Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Athe_2350
Name: yhcI Funciton: ABC-type multidrug transport system, permease component
Locus tag: Athe_2349
Name: yhcJ Funciton: Conserved membrane protein
Locus tag: Athe_2348
Name: yhcH Funciton: ABC transporter, ATP-binding protein
Locus tag: Athe_2347
Name: yhcK Funciton: Conserved membrane protein |
||||
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK | -42 | 6.7 | AGTGTATTATTTAATTAGTACACC | Athe_2352 |
Caldicellulosiruptor saccharolyticus DSM 8903 | ||||
Position: -43
Score: 6.75778 Sequence: AGTGTATTATTTAATTAACACACT
Locus tag: Csac_0140
Name: yhcF Funciton: Transcriptional regulator, GntR family
Locus tag: Csac_0141
Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Csac_0142
Name: yhcI Funciton: ABC-type multidrug transport system, permease component
Locus tag: Csac_0143
Name: yhcJ Funciton: Conserved membrane protein
Locus tag: Csac_0144
Name: yhcH Funciton: ABC transporter, ATP-binding protein
Locus tag: Csac_0145
Name: yhcK Funciton: Conserved membrane protein |
||||
yhcF-yhcG-yhcI-yhcJ-yhcH-yhcK | -43 | 6.8 | AGTGTATTATTTAATTAACACACT | Csac_0140 |