Orthologous regulated operons containing SCO2628 gene
| Regulog: | ArgR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ArgR |
| Regulation mode: | repressor (activator) |
| Biological process: | Arginine biosynthesis |
| Effector: | Arginine |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -28
Score: 3.92712 Sequence: CAGTGCAAGATCCTGCAGGA
Locus tag: SAV_3165
Name: SCO2628 Funciton: Predicted transcriptional regulator, LuxR family |
||||
| SCO2628 | -28 | 3.9 | CAGTGCAAGATCCTGCAGGA | SAV_3165 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -42
Score: 5.11436 Sequence: TGTGGCATGATCATGCATTG
Locus tag: SCO2686
Name: SCO2628 Funciton: Predicted transcriptional regulator, LuxR family |
||||
| SCO2628 | -42 | 5.1 | TGTGGCATGATCATGCATTG | SCO2686 |