Orthologous regulated operons containing yafH gene
| Regulog: | LexA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -73
Score: 4.26233 Sequence: AAATGTTTTTACATCCACTA
Locus tag: b0221
Name: yafH Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| yafH | -73 | 4.3 | AAATGTTTTTACATCCACTA | b0221 |
| Salmonella typhimurium LT2 | ||||
|
Position: -197
Score: 3.76006 Sequence: TACCGGATAGCAGTACAGGC
Locus tag: STM0309
Name: yafH Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| yafH | -197 | 3.8 | TACCGGATAGCAGTACAGGC | STM0309 |