Orthologous regulated operons containing recA gene
| Regulog: | LexA - Alcaligenaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bordetella avium 197N | ||||
|
Position: -172
Score: 5.83846 Sequence: TACTGTTTGTTTGTACAGTA
Locus tag: BAV2309
Name: recA Funciton: Recombinase A
Locus tag: BAV2308
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -172 | 5.8 | TACTGTTTGTTTGTACAGTA | BAV2309 |
| Bordetella bronchiseptica RB50 | ||||
|
Position: -135
Score: 5.68144 Sequence: CACTGGATTTTTATCCAGTA
Locus tag: BB2076
Name: recA Funciton: Recombinase A
Locus tag: BB2077
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -135 | 5.7 | CACTGGATTTTTATCCAGTA | BB2076 |
| Bordetella petrii DSM 12804 | ||||
|
Position: -136
Score: 5.99956 Sequence: TACTGGATTTTTATCCAGTA
Locus tag: Bpet2056
Name: recA Funciton: Recombinase A
Locus tag: Bpet2057
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -136 | 6 | TACTGGATTTTTATCCAGTA | Bpet2056 |