Orthologous regulated operons containing moaA gene
| Regulog: | ModE2 - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylobacillus flagellatus KT | ||||
|
Position: -48
Score: 6.01121 Sequence: TGTTAGTATTGACCGAAGGACTTACA
Locus tag: Mfla_2294
Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
Locus tag: Mfla_2295
Name: mobA Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: Mfla_2296
Name: mobB Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobB
Locus tag: Mfla_2297
Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA |
||||
| moaA-mobA-mobB-moeA | -48 | 6 | TGTTAGTATTGACCGAAGGACTTACA | Mfla_2294 |