Orthologous regulated operons containing mobA gene

Properties
Regulog:	ModE2 - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/Beta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Methylobacillus flagellatus KT
Position: -48 Score: 6.01121 Sequence: TGTTAGTATTGACCGAAGGACTTACA Locus tag: Mfla_2294 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA Locus tag: Mfla_2295 Name: mobA Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA Locus tag: Mfla_2296 Name: mobB Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobB Locus tag: Mfla_2297 Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA
moaA-mobA-mobB-moeA	-48	6	TGTTAGTATTGACCGAAGGACTTACA	Mfla_2294

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --