Orthologous regulated operons containing modA gene
| Regulog: | ModE2 - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylotenera mobilis JLW8 | ||||
|
Position: -139
Score: 6.42889 Sequence: TGTGATTAAATTGCACATTATTCAAA
Locus tag: Mmol_2127
Name: Mfla_0622 Funciton: Conserved hypothetical protein
Locus tag: Mmol_2128
Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Mmol_2129
Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Mmol_2130
Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
||||
| Mfla_0622-modA-modB-modC | -139 | 6.4 | TGTGATTAAATTGCACATTATTCAAA | Mmol_2127 |