Orthologous regulated operons containing modC gene
Regulog: | ModE2 - Various betaproteobacteria |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdopterin biosynthesis |
Effector: | Molybdate |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Methylotenera mobilis JLW8 | ||||
Position: -139
Score: 6.42889 Sequence: TGTGATTAAATTGCACATTATTCAAA
Locus tag: Mmol_2127
Name: Mfla_0622 Funciton: Conserved hypothetical protein
Locus tag: Mmol_2128
Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Mmol_2129
Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Mmol_2130
Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
||||
Mfla_0622-modA-modB-modC | -139 | 6.4 | TGTGATTAAATTGCACATTATTCAAA | Mmol_2127 |