Orthologous regulated operons containing Bxe_B1193 gene

Properties
Regulog:	ModE2 - Burkholderia
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/Beta

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia glumae BGR1
Position: -140 Score: 6.2212 Sequence: CGTTGTAAAGGTCGGTATATTACG Locus tag: bglu_2g05490 Name: mopI Funciton: Molybdopterin-binding protein Locus tag: bglu_2g05500 Name: Bxe_B1193 Funciton: Conserved hypothetical protein Locus tag: bglu_2g05510 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
mopI-Bxe_B1193-modE2	-140	6.2	CGTTGTAAAGGTCGGTATATTACG	bglu_2g05490
Burkholderia sp. 383
Position: -62 Score: 5.65527 Sequence: CGTAATATACCCGTCGATACAACG Locus tag: Bcep18194_B2795 Name: Bxe_B1193 Funciton: Conserved hypothetical protein Locus tag: Bcep18194_B2794 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
Bxe_B1193-modE2	-62	5.7	CGTAATATACCCGTCGATACAACG	Bcep18194_B2795
Burkholderia xenovorans LB400
Position: -67 Score: 6.10338 Sequence: CGTAATATACACACGGACATAACG Locus tag: Bxe_B1192 Name: Bxe_B1193 Funciton: Conserved hypothetical protein Locus tag: Bxe_B1193 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
Bxe_B1193-modE2	-67	6.1	CGTAATATACACACGGACATAACG	Bxe_B1192

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --