Orthologous regulated operons containing fdoI gene
Regulog: | ModE3 - Alcaligenaceae |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | |
Biological process: | Tungsten homeostasis |
Effector: | Tungsten |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bordetella petrii DSM 12804 | ||||
Position: -2
Score: 6.1879 Sequence: GTATGCAAAGCATTTCATAT
Locus tag: Bpet4663
Name: fdoX Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4662
Name: fdoG Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
Locus tag: Bpet4661
Name: fdoH Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
Locus tag: Bpet4660
Name: fdoY Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4659
Name: fdoI Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
Locus tag: Bpet4658
Name: fdoZ Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4657
Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2) |
||||
fdoX-fdoG-fdoH-fdoY-fdoI-fdoZ-fdhD | -2 | 6.2 | GTATGCAAAGCATTTCATAT | Bpet4663 |