Orthologous regulated operons containing modE3 gene
| Regulog: | ModE3 - Alcaligenaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | |
| Biological process: | Tungsten homeostasis |
| Effector: | Tungsten |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bordetella bronchiseptica RB50 | ||||
|
Position: -100
Score: 6.06855 Sequence: ATATGAAACGAATTGCATAG
Locus tag: BB2126
Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE |
||||
| modE3 | -100 | 6.1 | ATATGAAACGAATTGCATAG | BB2126 |
| Bordetella petrii DSM 12804 | ||||
|
Position: -67
Score: 6.07182 Sequence: ATATGAATAACTTTGCATAG
Locus tag: Bpet4656
Name: modE3 Funciton: Molybdate-responsive transcriptional regulator ModE |
||||
| modE3 | -67 | 6.1 | ATATGAATAACTTTGCATAG | Bpet4656 |