Orthologous regulated operons containing tupC gene
Regulog: | ModE3 - Alcaligenaceae |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | |
Biological process: | Tungsten homeostasis |
Effector: | Tungsten |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bordetella bronchiseptica RB50 | ||||
Position: -81
Score: 6.06855 Sequence: CTATGCAATTCGTTTCATAT
Locus tag: BB2127
Name: tupA Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: BB2128
Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: BB2129
Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein |
||||
tupA-tupC-tupB | -81 | 6.1 | CTATGCAATTCGTTTCATAT | BB2127 |
Bordetella petrii DSM 12804 | ||||
Position: -74
Score: 6.07182 Sequence: CTATGCAAAGTTATTCATAT
Locus tag: Bpet4655
Name: tupA Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Bpet4654
Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Bpet4653
Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein |
||||
tupA-tupC-tupB | -74 | 6.1 | CTATGCAAAGTTATTCATAT | Bpet4655 |