Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Ajs_3947 gene

Properties
Regulog: ModE3 - Comamonadaceae
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax sp. JS42
Position: -65
Score: 6.44664
Sequence: CTATGCAAATCTTTTCATAG
Locus tag: Ajs_3943
Name: Ajs_3943
Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein
Locus tag: Ajs_3944
Name: Ajs_3944
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase
Locus tag: Ajs_3945
Name: Ajs_3945
Funciton: NADH-dependent dehydrogenase, NADH-binding subunit
Locus tag: Ajs_3946
Name: Ajs_3946
Funciton: Conserved hypothetical protein
Locus tag: Ajs_3947
Name: Ajs_3947
Funciton: Conserved hypothetical protein
Ajs_3943-Ajs_3944-Ajs_3945-Ajs_3946-Ajs_3947 -65 6.4 CTATGCAAATCTTTTCATAG Ajs_3943
Leptothrix cholodnii SP-6
Position: -91
Score: 6.17166
Sequence: CTATGCAGATGATTGCATAG
Locus tag: Lcho_1816
Name: Ajs_3943
Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein
Locus tag: Lcho_1817
Name: Ajs_3944
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase
Locus tag: Lcho_1818
Name: Ajs_3945
Funciton: NADH-dependent dehydrogenase, NADH-binding subunit
Locus tag: Lcho_1819
Name: Ajs_3946
Funciton: Conserved hypothetical protein
Locus tag: Lcho_1820
Name: Ajs_3947
Funciton: Conserved hypothetical protein
Ajs_3943-Ajs_3944-Ajs_3945-Ajs_3946-Ajs_3947 -91 6.2 CTATGCAGATGATTGCATAG Lcho_1816
Polaromonas naphthalenivorans CJ2
Position: -60
Score: 5.94604
Sequence: CTATGCAAATCAATTCATAG
Locus tag: Pnap_0048
Name: Ajs_3943
Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein
Locus tag: Pnap_0049
Name: Ajs_3944
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase
Locus tag: Pnap_0050
Name: Ajs_3945
Funciton: NADH-dependent dehydrogenase, NADH-binding subunit
Locus tag: Pnap_0051
Name: Ajs_3946
Funciton: Conserved hypothetical protein
Locus tag: Pnap_0052
Name: Ajs_3947
Funciton: Conserved hypothetical protein
Ajs_3943-Ajs_3944-Ajs_3945-Ajs_3946-Ajs_3947 -60 5.9 CTATGCAAATCAATTCATAG Pnap_0048