Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tupC gene

Properties
Regulog: ModE3 - Comamonadaceae
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax sp. JS42
Position: -58
Score: 5.91135
Sequence: CTATGCACAAGTTTTCATAT
Locus tag: Ajs_3129
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Ajs_3128
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Ajs_3127
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -58 5.9 CTATGCACAAGTTTTCATAT Ajs_3129
Methylibium petroleiphilum PM1
Position: -102
Score: 5.32755
Sequence: CTATGCATGCTCGTTCATAT
Locus tag: Mpe_A2223
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Mpe_A2222
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Mpe_A2221
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
Locus tag: Mpe_A2220
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
tupA-tupC-tupB-modA -102 5.3 CTATGCATGCTCGTTCATAT Mpe_A2223
Polaromonas naphthalenivorans CJ2
Position: -84
Score: 5.75948
Sequence: CTATGCAAACAGCTTCATAA
Locus tag: Pnap_1509
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Pnap_1510
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Pnap_1511
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -84 5.8 CTATGCAAACAGCTTCATAA Pnap_1509
Polaromonas sp. JS666
Position: -85
Score: 5.76943
Sequence: CTATGCAAACCCATTCATAA
Locus tag: Bpro_1758
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Bpro_1759
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Bpro_1760
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -85 5.8 CTATGCAAACCCATTCATAA Bpro_1758
Rhodoferax ferrireducens DSM 15236
Position: -58
Score: 5.22138
Sequence: CTATGCACGGTGGTTCATAT
Locus tag: Rfer_2869
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Rfer_2868
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Rfer_2867
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -58 5.2 CTATGCACGGTGGTTCATAT Rfer_2869
Variovorax paradoxus S110
Position: -74
Score: 6.06821
Sequence: CTATGCAAAATCCTGCATAG
Locus tag: Vapar_1588
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Vapar_1589
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Vapar_1590
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -74 6.1 CTATGCAAAATCCTGCATAG Vapar_1588