Orthologous regulated operons containing fdsR gene
| Regulog: | FdsR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Formate oxydation |
| Effector: | Formate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Marinobacter sp. ELB17 | ||||
|
Position: -103
Score: 5.97273 Sequence: ATATGCATAATTGTTCCTAC
Position: -12
Score: 5.78652 Sequence: ATATGAATAAAATTGCATAA
Locus tag: MELB17_23345
Name: fdsR Funciton: Formate dehydrogenase transcriptional regulator FdsR, ModE family |
||||
| fdsR | -103 | 6 | ATATGCATAATTGTTCCTAC | MELB17_23345 |
| -12 | 5.8 | ATATGAATAAAATTGCATAA | ||