Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing modE gene

Properties
Regulog: ModE - Rhizobiales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -54
Score: 4.45888
Sequence: TTATATAGTTCTTGCATATGA
Locus tag: RPA4718
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: RPA4717
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: RPA4716
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: RPA4715
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modE-modA-modB-modC -54 4.5 TTATATAGTTCTTGCATATGA RPA4718