Orthologous regulated operons containing modE gene
| Regulog: | ModE - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -54
Score: 4.45888 Sequence: TTATATAGTTCTTGCATATGA
Locus tag: RPA4718
Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: RPA4717
Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: RPA4716
Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: RPA4715
Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein |
||||
| modE-modA-modB-modC | -54 | 4.5 | TTATATAGTTCTTGCATATGA | RPA4718 |