Orthologous regulated operons containing RPA0151 gene

Properties
Regulog:	ModE - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/Alpha

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -79 Score: 5.19079 Sequence: TTGTTTACTCAGATTACATAT Locus tag: RPA0152 Name: RPA0152 Funciton: Hypothetical protein Locus tag: RPA0151 Name: RPA0151 Funciton: Putative ABC transporter, substrate-binding protein Locus tag: RPA0150 Name: RPA0150 Funciton: Putative ABC transporter, permease protein Locus tag: RPA0149 Name: RPA0149 Funciton: Putative ABC transporter, ATP-binding protein Locus tag: RPA0148 Name: modC2 Funciton: ABC-type molybdate transport system, ATP-binding protein Locus tag: RPA0147 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
RPA0152-RPA0151-RPA0150-RPA0149-modC2-modE	-79	5.2	TTGTTTACTCAGATTACATAT	RPA0152

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --