Orthologous regulated operons containing modA gene
Regulog: | ModE - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdopterin biosynthesis |
Effector: | Molybdate |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Rhodopseudomonas palustris CGA009 | ||||
Position: -54
Score: 4.45888 Sequence: TTATATAGTTCTTGCATATGA
Locus tag: RPA4718
Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: RPA4717
Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: RPA4716
Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: RPA4715
Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein |
||||
modE-modA-modB-modC | -54 | 4.5 | TTATATAGTTCTTGCATATGA | RPA4718 |