Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing AHA_1967 gene

Properties
Regulog: Fur - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: 109
Score: 5.72154
Sequence: AAATAAAAATGATTACCATTT
Locus tag: AHA_1970
Name: AHA_1970
Funciton: hypothetical protein
Locus tag: AHA_1969
Name: fstC
Funciton: Colicin I receptor precursor
Locus tag: AHA_1968
Name: AHA_1968
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: AHA_1967
Name: AHA_1967
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: AHA_1966
Name: fecE
Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
AHA_1970-fstC-AHA_1968-AHA_1967-fecE 109 5.7 AAATAAAAATGATTACCATTT AHA_1970
Aeromonas salmonicida subsp. salmonicida A449
Position: -80
Score: 5.72154
Sequence: AAATAAAAATGATTACCATTT
Locus tag: ASA_1851
Name: AHA_1970
Funciton: hypothetical protein
Locus tag: ASA_1850
Name: fstC
Funciton: Colicin I receptor precursor
Locus tag: ASA_1849
Name: AHA_1968
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: ASA_1848
Name: AHA_1967
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: ASA_1847
Name: fecE
Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
AHA_1970-fstC-AHA_1968-AHA_1967-fecE -80 5.7 AAATAAAAATGATTACCATTT ASA_1851