Orthologous regulated operons containing hutA gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -81
Score: 5.20837 Sequence: GAATGATAGTAATTACCATTT
Locus tag: VIBHAR_05789
Name: hutA Funciton: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
||||
| hutA | -81 | 5.2 | GAATGATAGTAATTACCATTT | VIBHAR_05789 |