Orthologous regulated operons containing fecB gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -69
Score: 5.31972 Sequence: AAATAAAAATAGTTATCAATC
Locus tag: PBPRB1817
Name: fecB Funciton: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
||||
| fecB | -69 | 5.3 | AAATAAAAATAGTTATCAATC | PBPRB1817 |