Orthologous regulated operons containing pVSAL320_28 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio salmonicida LFI1238 | ||||
|
Position: -66
Score: 5.72704 Sequence: AAATGAGATTCATTATTATTA
Locus tag: pVSAL320_27
Name: null Funciton: putative periplasmic iron siderophore binding protein of ABC transporter
Locus tag: pVSAL320_28
Name: null Funciton: transport system permease protein
Locus tag: pVSAL320_29
Name: null Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Locus tag: pVSAL320_30
Name: null Funciton: hypothetical protein |
||||
| pVSAL320_27-pVSAL320_28-pVSAL320_29-pVSAL320_30 | -66 | 5.7 | AAATGAGATTCATTATTATTA | pVSAL320_27 |