Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pVSAL320_28 gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio salmonicida LFI1238
Position: -66
Score: 5.72704
Sequence: AAATGAGATTCATTATTATTA
Locus tag: pVSAL320_27
Name: null
Funciton: putative periplasmic iron siderophore binding protein of ABC transporter
Locus tag: pVSAL320_28
Name: null
Funciton: transport system permease protein
Locus tag: pVSAL320_29
Name: null
Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Locus tag: pVSAL320_30
Name: null
Funciton: hypothetical protein
pVSAL320_27-pVSAL320_28-pVSAL320_29-pVSAL320_30 -66 5.7 AAATGAGATTCATTATTATTA pVSAL320_27