Orthologous regulated operons containing sufC gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio splendidus LGP32 | ||||
|
Position: -207
Score: 5.84201 Sequence: TAATGATAATCATTATTAATA
Position: -102
Score: 4.50736 Sequence: ATATGCAAATGATAATCAATA
Position: -96
Score: 5.71637 Sequence: AAATGATAATCAATATCATCT
Locus tag: VS_1901
Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: VS_1902
Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: VS_1903
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: VS_1904
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: VS_1905
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: VS_1906
Name: sufE Funciton: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
||||
| iscA-sufB-sufC-sufD-sufS-sufE | -207 | 5.8 | TAATGATAATCATTATTAATA | VS_1901 |
| -102 | 4.5 | ATATGCAAATGATAATCAATA | ||
| -96 | 5.7 | AAATGATAATCAATATCATCT | ||