Orthologous regulated operons containing PBPRB1032 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -141
Score: 4.92052 Sequence: TAATACAAATAATAATTATTT
Position: -135
Score: 5.94493 Sequence: AAATAATAATTATTTTCATTA
Locus tag: PBPRB1034
Name: null Funciton: hypothetical protein
Locus tag: PBPRB1033
Name: null Funciton: hypothetical protein
Locus tag: PBPRB1032
Name: null Funciton: High-affinity iron permease
Locus tag: PBPRB1031
Name: null Funciton: BarJ
Locus tag: PBPRB1030
Name: null Funciton: hypothetical protein
Locus tag: PBPRB1029
Name: null Funciton: hypothetical protein |
||||
| PBPRB1034-PBPRB1033-PBPRB1032-PBPRB1031-PBPRB1030-PBPRB1029 | -141 | 4.9 | TAATACAAATAATAATTATTT | PBPRB1034 |
| -135 | 5.9 | AAATAATAATTATTTTCATTA | ||