Orthologous regulated operons containing sitD gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Vibrio angustum S14 | ||||
Position: -89
Score: 6.07483 Sequence: TATTGATAATAATTATCAATT
Position: -83
Score: 4.75015 Sequence: TAATAATTATCAATTGCATTT
Locus tag: VAS14_10539
Name: sitA Funciton: Manganese ABC transporter, periplasmic-binding protein SitA
Locus tag: VAS14_10534
Name: sitB Funciton: Manganese ABC transporter, ATP-binding protein SitB
Locus tag: VAS14_10529
Name: sitC Funciton: Manganese ABC transporter, inner membrane permease protein SitC
Locus tag: VAS14_10524
Name: sitD Funciton: Manganese ABC transporter, inner membrane permease protein SitD |
||||
sitA-sitB-sitC-sitD | -89 | 6.1 | TATTGATAATAATTATCAATT | VAS14_10539 |
-83 | 4.8 | TAATAATTATCAATTGCATTT |