Orthologous regulated operons containing VSAK1_18252 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio shilonii AK1 | ||||
|
Position: -78
Score: 6.27995 Sequence: TAATGATAATGATTATCATTT
Position: -72
Score: 4.52617 Sequence: TAATGATTATCATTTTAATCT
Locus tag: VSAK1_18252
Name: null Funciton: TonB-dependent heme receptor |
||||
| VSAK1_18252 | -78 | 6.3 | TAATGATAATGATTATCATTT | VSAK1_18252 |
| -72 | 4.5 | TAATGATTATCATTTTAATCT | ||