Orthologous regulated operons containing COG4773 gene
Regulog: | Fur - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -31
Score: 4.61897 Sequence: GGATAAGAATCGTTATCATTG
Locus tag: XCC4162
Name: COG4773 Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent |
||||
COG4773 | -31 | 4.6 | GGATAAGAATCGTTATCATTG | XCC4162 |