Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fecA4 gene

Properties
Regulog: Fur - Xanthomonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 49 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -87
Score: 4.61891
Sequence: GGATGCAAATGATTCTCTTTT
Locus tag: Smlt2935
Name: fecI4
Funciton: putative ECF-family sigma factor for iron metabolism
Locus tag: Smlt2936
Name: fecR4
Funciton: putative transcriptional regulatory FecR iron transport regulator family protein
Locus tag: Smlt2937
Name: fecA4
Funciton: putative TonB dependent receptor protein
Locus tag: Smlt2938
Name: null
Funciton: putative iron regulated lipoprotein
Locus tag: Smlt2939
Name: null
Funciton: putative TonB-like protein
fecI4-fecR4-fecA4-Smlt2938-Smlt2939 -87 4.6 GGATGCAAATGATTCTCTTTT Smlt2935