Orthologous regulated operons containing fecA3 gene
| Regulog: | Fur - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -69
Score: 5.05638 Sequence: GAACGTGACTGATTCTCATTA
Locus tag: Smlt3900
Name: fecI3 Funciton: putative RNA polymerase ECF sigma factor for iron metabolism
Locus tag: Smlt3899
Name: fecR3 Funciton: putative transmembrane FecR sensor protein
Locus tag: Smlt3898
Name: fecA3 Funciton: putative extracellular heme-binding protein, TonB-dependent |
||||
| fecI3-fecR3-fecA3 | -69 | 5.1 | GAACGTGACTGATTCTCATTA | Smlt3900 |