Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fecR3 gene

Properties
Regulog: Fur - Xanthomonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 49 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -69
Score: 5.05638
Sequence: GAACGTGACTGATTCTCATTA
Locus tag: Smlt3900
Name: fecI3
Funciton: putative RNA polymerase ECF sigma factor for iron metabolism
Locus tag: Smlt3899
Name: fecR3
Funciton: putative transmembrane FecR sensor protein
Locus tag: Smlt3898
Name: fecA3
Funciton: putative extracellular heme-binding protein, TonB-dependent
fecI3-fecR3-fecA3 -69 5.1 GAACGTGACTGATTCTCATTA Smlt3900
© 2009-2020 RegPrecise