Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fecA2 gene

Properties
Regulog: Fur - Xanthomonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 49 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -86
Score: 5.38769
Sequence: AAACGCGAACGGTTCCCATTA
Locus tag: Smlt2664
Name: fecI2
Funciton: putative RNA polymerase sigma factor for iron metabolism
Locus tag: Smlt2665
Name: fecR2
Funciton: putative iron uptake transcriptional regulator protein
Locus tag: Smlt2666
Name: fecA2
Funciton: putative TonB-dependent ferric siderophore receptor
fecI2-fecR2-fecA2 -86 5.4 AAACGCGAACGGTTCCCATTA Smlt2664
© 2009-2020 RegPrecise