Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fecR gene

Properties
Regulog: Fur - Xanthomonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 49 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -28
Score: 5.7748
Sequence: TAATGGGAATCATTCGCATTA
Locus tag: Smlt2848
Name: fecI
Funciton: Putative RNA polymerase sigma factor for iron metabolism
Locus tag: Smlt2849
Name: fecR
Funciton: Putative transmembrane FecR family iron uptake regulator protein
Locus tag: Smlt2850
Name: fecA
Funciton: putative TonB dependent extracellular heme-binding protein
fecI-fecR-fecA -28 5.8 TAATGGGAATCATTCGCATTA Smlt2848
© 2009-2020 RegPrecise