Orthologous regulated operons containing fhuE gene
Regulog: | Fur - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -120
Score: 5.95085 Sequence: AAATGTGAATCATTCCCATTA
Locus tag: XAC3370
Name: fhuE Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent |
||||
fhuE | -120 | 6 | AAATGTGAATCATTCCCATTA | XAC3370 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -121
Score: 5.95085 Sequence: AAATGTGAATCATTCCCATTA
Locus tag: XCC3216
Name: fhuE Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
Locus tag: XCC3215
Name: fhuE Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent |
||||
fhuE-fhuE | -121 | 6 | AAATGTGAATCATTCCCATTA | XCC3216 |