Orthologous regulated operons containing bfd gene
| Regulog: | Fur - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -81
Score: 4.24574 Sequence: CAATGCGCACGATTCGCGTTC
Position: -73
Score: 5.38699 Sequence: GATTGACAACCATTCTCGTTT
Locus tag: Smlt4298
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: Smlt4297
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -81 | 4.2 | CAATGCGCACGATTCGCGTTC | Smlt4298 |
| -73 | 5.4 | GATTGACAACCATTCTCGTTT | ||
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -73
Score: 5.04459 Sequence: AATTGACACCTATTCTCGTTT
Locus tag: XAC0492
Name: bfd Funciton: Bacterioferritin-associated ferredoxin |
||||
| bfd | -73 | 5 | AATTGACACCTATTCTCGTTT | XAC0492 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -73
Score: 5.04459 Sequence: AATTGACACCTATTCTCGTTT
Locus tag: XCC0481
Name: bfd Funciton: Bacterioferritin-associated ferredoxin |
||||
| bfd | -73 | 5 | AATTGACACCTATTCTCGTTT | XCC0481 |
| Xylella fastidiosa 9a5c | ||||
|
Position: -64
Score: 5.36465 Sequence: AATTGACATTCATTCTCATCT
Locus tag: XF0394
Name: bfd Funciton: Bacterioferritin-associated ferredoxin |
||||
| bfd | -64 | 5.4 | AATTGACATTCATTCTCATCT | XF0394 |