Orthologous regulated operons containing PE36_21054 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -81 Score: 5.28269 Sequence: AAATAAGAACGATTCCTATTT Locus tag: PE36_21054 Name: null Funciton: TonB-dependent receptor
PE36_21054	-81	5.3	AAATAAGAACGATTCCTATTT	PE36_21054

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --