Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Tola_2912 gene

Properties
Regulog: Fur - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Tolumonas auensis DSM 9187
Position: -95
Score: 5.29473
Sequence: AGATGAAAAGGGTTATCAATA
Locus tag: Tola_2912
Name: null
Funciton: ferric uptake regulator family protein
Tola_2912 -95 5.3 AGATGAAAAGGGTTATCAATA Tola_2912