Orthologous regulated operons containing PCNPT3_00171 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -106 Score: 4.86807 Sequence: TAAATACAATGATTCTCATTT Locus tag: PE36_07037 Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component Locus tag: PE36_07032 Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein Locus tag: PE36_07027 Name: exbB2 Funciton: Biopolymer transport protein ExbB Locus tag: PE36_07022 Name: exbD2 Funciton: Biopolymer transport protein ExbD Locus tag: PE36_07017 Name: tonB2 Funciton: TonB protein Locus tag: PE36_07012 Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system
PCNPT3_00166-PCNPT3_00171-exbB2-exbD2-tonB2-PCNPT3_00191	-106	4.9	TAAATACAATGATTCTCATTT	PE36_07037
Psychromonas sp. CNPT3
Position: -162 Score: 5.37342 Sequence: TGGTGATAATGGTTATCATTA Locus tag: PCNPT3_00166 Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component Locus tag: PCNPT3_00171 Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein Locus tag: PCNPT3_00176 Name: exbB2 Funciton: Biopolymer transport protein ExbB Locus tag: PCNPT3_00181 Name: exbD2 Funciton: Biopolymer transport protein ExbD Locus tag: PCNPT3_00186 Name: tonB2 Funciton: TonB protein Locus tag: PCNPT3_00191 Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system
PCNPT3_00166-PCNPT3_00171-exbB2-exbD2-tonB2-PCNPT3_00191	-162	5.4	TGGTGATAATGGTTATCATTA	PCNPT3_00166

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --