Orthologous regulated operons containing PCNPT3_00171 gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -106
Score: 4.86807 Sequence: TAAATACAATGATTCTCATTT
Locus tag: PE36_07037
Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component
Locus tag: PE36_07032
Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein
Locus tag: PE36_07027
Name: exbB2 Funciton: Biopolymer transport protein ExbB
Locus tag: PE36_07022
Name: exbD2 Funciton: Biopolymer transport protein ExbD
Locus tag: PE36_07017
Name: tonB2 Funciton: TonB protein
Locus tag: PE36_07012
Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system |
||||
| PCNPT3_00166-PCNPT3_00171-exbB2-exbD2-tonB2-PCNPT3_00191 | -106 | 4.9 | TAAATACAATGATTCTCATTT | PE36_07037 |
| Psychromonas sp. CNPT3 | ||||
|
Position: -162
Score: 5.37342 Sequence: TGGTGATAATGGTTATCATTA
Locus tag: PCNPT3_00166
Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component
Locus tag: PCNPT3_00171
Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein
Locus tag: PCNPT3_00176
Name: exbB2 Funciton: Biopolymer transport protein ExbB
Locus tag: PCNPT3_00181
Name: exbD2 Funciton: Biopolymer transport protein ExbD
Locus tag: PCNPT3_00186
Name: tonB2 Funciton: TonB protein
Locus tag: PCNPT3_00191
Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system |
||||
| PCNPT3_00166-PCNPT3_00171-exbB2-exbD2-tonB2-PCNPT3_00191 | -162 | 5.4 | TGGTGATAATGGTTATCATTA | PCNPT3_00166 |