Orthologous regulated operons containing hemD gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -105
Score: 4.77445 Sequence: TAATAAAAATCATTTTCAGCG
Locus tag: AHA_0469
Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61)
Locus tag: AHA_0468
Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75)
Locus tag: AHA_0467
Name: hemX Funciton: uroporphyrin-III C-methyltransferase HemX
Locus tag: AHA_0466
Name: hemY Funciton: HemY protein |
||||
| hemC-hemD-hemX-hemY | -105 | 4.8 | TAATAAAAATCATTTTCAGCG | AHA_0469 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -105
Score: 5.39232 Sequence: TAATGAAAATCATTTTCAGCA
Locus tag: ASA_3875
Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61)
Locus tag: ASA_3876
Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75)
Locus tag: ASA_3877
Name: hemX Funciton: uroporphyrin-III C-methyltransferase HemX
Locus tag: ASA_3878
Name: hemY Funciton: HemY protein |
||||
| hemC-hemD-hemX-hemY | -105 | 5.4 | TAATGAAAATCATTTTCAGCA | ASA_3875 |