Orthologous regulated operons containing Tola_1488 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Tolumonas auensis DSM 9187
Position: -68 Score: 5.44644 Sequence: TAATGCGAATGGTTATCAATA Locus tag: Tola_1488 Name: null Funciton: TonB-dependent siderophore receptor
Tola_1488	-68	5.4	TAATGCGAATGGTTATCAATA	Tola_1488

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --