Orthologous regulated operons containing PE36_17310 gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -75
Score: 5.45503 Sequence: GAATGATAGTAATTCTCATTT
Locus tag: PE36_17310
Name: null Funciton: heme transport protein HutA |
||||
| PE36_17310 | -75 | 5.5 | GAATGATAGTAATTCTCATTT | PE36_17310 |