Orthologous regulated operons containing PE36_09918 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -79 Score: 5.66441 Sequence: AAATGAGAATTATTCTTATAA Locus tag: PE36_09918 Name: PE36_09918 Funciton: Transcriptional regulator, AraC family
PE36_09918	-79	5.7	AAATGAGAATTATTCTTATAA	PE36_09918

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --