Orthologous regulated operons containing PCNPT3_00266 gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychromonas sp. CNPT3 | ||||
|
Position: -58
Score: 5.69358 Sequence: TAATGGTAATTATTATCAATT
Locus tag: PCNPT3_00271
Name: ftr1 Funciton: High-affinity Fe2+/Pb2+ permease
Locus tag: PCNPT3_00266
Name: null Funciton: Periplasmic protein p19 involved in high-affinity Fe2+ transport |
||||
| ftr1-PCNPT3_00266 | -58 | 5.7 | TAATGGTAATTATTATCAATT | PCNPT3_00271 |