Orthologous regulated operons containing PE36_21059 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -42 Score: 4.61343 Sequence: TATTGGTTATCATTCTCATCA Locus tag: PE36_21074 Name: PCNPT3_10053 Funciton: ABC transporter ATP-binding protein Locus tag: PE36_21069 Name: null Funciton: putative Iron-compound ABC transporter, permease protein Locus tag: PE36_21064 Name: null Funciton: iron(III) dicitrate transport system permease protein Locus tag: PE36_21059 Name: null Funciton: putative ferrichrome-binding protein
PCNPT3_10053-PE36_21069-PE36_21064-PE36_21059	-42	4.6	TATTGGTTATCATTCTCATCA	PE36_21074

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --