Orthologous regulated operons containing PE36_11667 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -76 Score: 4.89319 Sequence: CTGTGATAATGATTTTTATTT Position: -70 Score: 4.75089 Sequence: TAATGATTTTTATTTGCAATT Position: -53 Score: 5.7981 Sequence: AATTGATAATAAATCTCATTA Locus tag: PE36_11667 Name: null Funciton: hypothetical protein Locus tag: PE36_11662 Name: null Funciton: ABC transporter, ATP-binding protein
PE36_11667-PE36_11662	-76	4.9	CTGTGATAATGATTTTTATTT	PE36_11667
	-70	4.8	TAATGATTTTTATTTGCAATT
	-53	5.8	AATTGATAATAAATCTCATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --