Orthologous regulated operons containing exbB1 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -123 Score: 4.58819 Sequence: GATTGATAATGGTTGTTGTTT Locus tag: AHA_1987 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: AHA_1986 Name: exbB1 Funciton: Biopolymer transport protein ExbB Locus tag: AHA_1985 Name: exbD1 Funciton: Biopolymer transport protein ExbD
tonB1-exbB1-exbD1	-123	4.6	GATTGATAATGGTTGTTGTTT	AHA_1987
Aeromonas salmonicida subsp. salmonicida A449
Position: -33 Score: 4.90053 Sequence: GATTGATAATAGTTATTGTTT Locus tag: ASA_1867 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: ASA_1866 Name: exbB1 Funciton: Biopolymer transport protein ExbB Locus tag: ASA_1865 Name: exbD1 Funciton: Biopolymer transport protein ExbD
tonB1-exbB1-exbD1	-33	4.9	GATTGATAATAGTTATTGTTT	ASA_1867
Tolumonas auensis DSM 9187
Position: -79 Score: 5.88429 Sequence: AAATAATAATGGTTCTCATTA Locus tag: Tola_1802 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: Tola_1801 Name: exbB1 Funciton: Biopolymer transport protein ExbB Locus tag: Tola_1800 Name: exbD1 Funciton: Biopolymer transport protein ExbD
tonB1-exbB1-exbD1	-79	5.9	AAATAATAATGGTTCTCATTA	Tola_1802

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --