Orthologous regulated operons containing feoB gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -38 Score: 5.01116 Sequence: AAAAGAGAATTATTATTGTTT Locus tag: AHA_2744 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: AHA_2743 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: AHA_2742 Name: feoC Funciton: Ferrous iron transport protein C
feoA-feoB-feoC	-38	5	AAAAGAGAATTATTATTGTTT	AHA_2744
Aeromonas salmonicida subsp. salmonicida A449
Position: -38 Score: 4.64855 Sequence: AAAAGCGAATTATTATTGTTT Locus tag: ASA_1629 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: ASA_1630 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: ASA_1631 Name: feoC Funciton: Ferrous iron transport protein C
feoA-feoB-feoC	-38	4.6	AAAAGCGAATTATTATTGTTT	ASA_1629
Tolumonas auensis DSM 9187
Position: -35 Score: 5.4523 Sequence: TATTAATAATGATTCTCAATA Locus tag: Tola_2146 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Tola_2145 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: Tola_2144 Name: feoC Funciton: Ferrous iron transport protein C
feoA-feoB-feoC	-35	5.5	TATTAATAATGATTCTCAATA	Tola_2146

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --